SeqBench MCP Server & API

Call SeqBench’s sequence tools straight from an AI agent or your own code. The same pure algorithms behind the website are exposed as a Model Context Protocol (MCP) server and a plain JSON REST API. No key required.

Connect via MCP

Add the Streamable-HTTP endpoint https://seqbench.com/api/mcp to your MCP client (Claude Code, Claude Desktop, Cursor, …). For example:

{
  "mcpServers": {
    "seqbench": {
      "type": "http",
      "url": "https://seqbench.com/api/mcp"
    }
  }
}

A client that only supports stdio servers can bridge to this URL with npx mcp-remote https://seqbench.com/api/mcp.

Use the REST API

Every tool is also at POST /api/v1/<tool> with a JSON body. List all tools and their schemas at GET /api/v1.

curl -X POST https://seqbench.com/api/v1/melting_temperature \
  -H "Content-Type: application/json" \
  -d '{"sequence":"GCGGATCCATGAGCAAAGGAGAAGAA"}'

Tools (10)

Tool	Description
reverse_complement	Reverse complement (and complement) of a DNA or RNA sequence.
translate	Translate a nucleotide sequence to protein in a given reading frame (standard genetic code).
gc_content	GC content, AT content and base composition of a sequence.
melting_temperature	Primer/oligo melting temperature: nearest-neighbour (SantaLucia 1998) plus Wallace and salt-adjusted estimates.
oligo_analysis	Full oligo analysis: nearest-neighbour Tm/ΔG plus hairpin and self-dimer screening.
find_orfs	Find open reading frames (ATG…stop) across all six frames.
restriction_sites	Find restriction enzyme recognition sites in a DNA sequence.
codon_optimize	Codon-optimise a protein sequence for an expression host (most-frequent codon).
protein_properties	Protein properties: molecular weight, isoelectric point, GRAVY, extinction coefficient and composition.
in_silico_pcr	Predict PCR products for a template and a pair of primers (IUPAC-aware, allows mismatches).

API version 1.0.0. Results are for research/educational use; verify critical results against an authoritative source.